RNA-Seq of Eurycercus cf. lamellatus - SRA

SRX2458854: RNA-Seq of Eurycercus cf. lamellatus
1 ILLUMINA (Illumina HiSeq 2500) run: 34.9M spots, 17.4G bases, 9.7Gb downloads

Design: Total RNA was extracted using TRIzol. mRNA was purified with magnetic oligo(dt) coated Dynabeads. Fragmented cDNA library with 200 bp fragment sizes was constructed using SuperScript III reverse transcriptase and the PrepX library preparation kit on an Apollo 324. The PrepX kit was used for indexing with indices: AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG, GATCGTCGGACTGTAGAACTCTGAACGTGTAGATCTCGGTGGTCGCCGTATCATT (indices are reverse-complimented to be used directly in Trimgalore). The library was PCR amplified with the KAPA Library Amplification kit and assessed and quantified with the HSDNA Bioanalyzer and qPCR (KAPA Library Quantification). The speciemen has been registered with the Museum of Comparative Zoology, and can be accessed at http://mczbase.mcz.harvard.edu/guid/MCZ:IZ:50045

Submitted by: Harvard University

Study: Phylogeny of Tetraconata with special focus on Crustacea

PRJNA358279 • SRP095961 • All experiments • All runs

show Abstracthide Abstract

The goal of this study is to use large-scale transcriptome analyses to elucidate the phylogenetic relationships within Tetraconata with an emphasis on “Crustacea” and Malacostraca and Branchiopoda therein.

Sample:

SAMN06174134 • SRS1891807 • All experiments • All runs

Organism: Eurycercus cf. lamellatus MCZ IZ 50045

Library:

Name: MCZ IZ 50045

Instrument: Illumina HiSeq 2500

Strategy: RNA-Seq

Source: TRANSCRIPTOMIC

Selection: cDNA

Layout: PAIRED

Runs: 1 run, 34.9M spots, 17.4G bases, 9.7Gb

Run	# of Spots	# of Bases	Size	Published
SRR5140146	34,867,412	17.4G	9.7Gb	2018-02-01

ID:: 3571216

SRA

Sequence Read Archive

Result Filters

Send to:

Supplemental Content

Related information

Recent activity